Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 1605412
End position: 1605435
Length: 24

DNA sequence
>NC_008570, from 1605412 to 1605435 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 TCAATGGGTCAATGGGTCACTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1605429-1606637	Sequence	AHA_1473 - Na(+)/H(+) antiporter (Protein is coded in complementary strand; from 1606637 to 1605429)