Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 1921542
End position: 1921565
Length: 24

DNA sequence
>NC_008570, from 1921542 to 1921565 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 AGACCATGACCAACACCAAGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1921449-1922564	Sequence	AHA_1759 ispG 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase