Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 2264431
End position: 2264454
Length: 24

DNA sequence
>NC_008570, from 2264431 to 2264454 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 GCTGCTCCTGCTGCTGTTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2263038-2264825	Sequence	AHA_2059 - cyclic nucleotide binding protein/CBS domain-containing proteins (Protein is coded in complementary strand; from 2264825 to 2263038)