Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 2594993
End position: 2595028
Length: 36

DNA sequence
>NC_008570, from 2594993 to 2595028 (36 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 ACCGGCCAGGAAACCGGCCACGATACCGCCAAGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2594283-2596007	Sequence	AHA_2346 fruA PTS system, fructose-specific, IIBC component (Protein is coded in complementary strand; from 2596007 to 2594283)