Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 2738618
End position: 2738653
Length: 36

DNA sequence
>NC_008570, from 2738618 to 2738653 (36 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 AGAGAAGTGGAGAGAGAAGTAAAGAGACAAGTGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2738070-2738669	Sequence	AHA_2469 - thiol:disulfide interchange protein DsbE