Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 2930253
End position: 2930276
Length: 24

DNA sequence
>NC_008570, from 2930253 to 2930276 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 CCACCGCCACCACCAGCGCCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2929838-2931313	Sequence	AHA_2628 - arginine/ornithine antiporter (Protein is coded in complementary strand; from 2931313 to 2929838)