Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 3049597
End position: 3049620
Length: 24

DNA sequence
>NC_008570, from 3049597 to 3049620 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 CTTGGCCTCGGCCATGGCCTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3049538-3050764	Sequence	AHA_2715 - ATP-dependent RNA helicase RhlE (Protein is coded in complementary strand; from 3050764 to 3049538)