Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 3238548
End position: 3238571
Length: 24

DNA sequence
>NC_008570, from 3238548 to 3238571 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 TGAAAAAATGAAAAAATGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3237765-3238838	Sequence	AHA_2882 - hypothetical protein (Protein is coded in complementary strand; from 3238838 to 3237765)