Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 3255216
End position: 3255240
Length: 25

DNA sequence
>NC_008570, from 3255216 to 3255240 (25 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 TTTTTCTTTTTTTTCTTTTCGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3253868-3255508	Sequence	AHA_2897 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 3255508 to 3253868)