Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 3366779
End position: 3366802
Length: 24

DNA sequence
>NC_008570, from 3366779 to 3366802 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 CCACCAGCACCACGACCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3365969-3367132	Sequence	AHA_2989 - macrolide-specific efflux protein MacA