Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 3451696
End position: 3451719
Length: 24

DNA sequence
>NC_008570, from 3451696 to 3451719 (24 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 CACGGTCAGGGTCACGGCCACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3451559-3452854	Sequence	AHA_3056 uraA uracil permease (Protein is coded in complementary strand; from 3452854 to 3451559)