Sequence retrieval

Genome: Aeromonas hydrophila subsp. hydrophila ATCC 7966
Start position: 3465864
End position: 3465899
Length: 36

DNA sequence
>NC_008570, from 3465864 to 3465899 (36 bp); Aeromonas hydrophila subsp. hydrophila ATCC 7966 TGTTTCCGGCACAGGTTCCGGCACTGTTTCCAGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3465244-3465921	Sequence	AHA_3067 - hypothetical protein (Protein is coded in complementary strand; from 3465921 to 3465244)
ORF. 3465839-3466429	Sequence	AHA_3068 - hypothetical protein (Protein is coded in complementary strand; from 3466429 to 3465839)