Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1028960
End position: 1028989
Length: 30

DNA sequence
>NC_008702, from 1028960 to 1028989 (30 bp); Azoarcus sp. BH72 GCAGGGGGCGCCACGGGGCGGGAGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1027781-1029013	Sequence	azo0956 cfa1 cyclopropane-fatty-acyl-phospholipid synthase (Protein is coded in complementary strand; from 1029013 to 1027781)