Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1244871
End position: 1244894
Length: 24

DNA sequence
>NC_008702, from 1244871 to 1244894 (24 bp); Azoarcus sp. BH72 CGCCATCGCCATCACCATCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1244251-1245189	Sequence	azo1156 - hypothetical protein (Protein is coded in complementary strand; from 1245189 to 1244251)