Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1404748
End position: 1404771
Length: 24

DNA sequence
>NC_008702, from 1404748 to 1404771 (24 bp); Azoarcus sp. BH72 ACAGCGGCAGCGTCAGCGACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1403946-1406627	Sequence	azo1293 glnE bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase (Protein is coded in complementary strand; from 1406627 to 1403946)