Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1444657
End position: 1444680
Length: 24

DNA sequence
>NC_008702, from 1444657 to 1444680 (24 bp); Azoarcus sp. BH72 CGCCGCGGCCGCCGACGCCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1443843-1445237	Sequence	azo1327 hflX2 GTP-binding protein HflX (Protein is coded in complementary strand; from 1445237 to 1443843)