Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1451764
End position: 1451787
Length: 24

DNA sequence
>NC_008702, from 1451764 to 1451787 (24 bp); Azoarcus sp. BH72 CGCGAGCGCGCGGGCGAGCGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1451135-1452220	Sequence	azo1333 cysA putative sulfate transport ATP-binding protein (Protein is coded in complementary strand; from 1452220 to 1451135)