Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1496474
End position: 1496497
Length: 24

DNA sequence
>NC_008702, from 1496474 to 1496497 (24 bp); Azoarcus sp. BH72 AGCCGGGGCCGGAGCAGGAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1495116-1496804	Sequence	azo1372 pdhB dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 1496804 to 1495116)