Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1600103
End position: 1600126
Length: 24

DNA sequence
>NC_008702, from 1600103 to 1600126 (24 bp); Azoarcus sp. BH72 GCCGGCGCCCGCGCAGGCGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1599814-1601193	Sequence	azo1467 xseA exodeoxyribonuclease VII (Protein is coded in complementary strand; from 1601193 to 1599814)