Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1916729
End position: 1916752
Length: 24

DNA sequence
>NC_008702, from 1916729 to 1916752 (24 bp); Azoarcus sp. BH72 GGCTCCGGTTCCGGCTCCGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1916675-1917442	Sequence	azo1747 - hypothetical protein (Protein is coded in complementary strand; from 1917442 to 1916675)