Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 1958749
End position: 1958772
Length: 24

DNA sequence
>NC_008702, from 1958749 to 1958772 (24 bp); Azoarcus sp. BH72 CGCCGCCCCCGCCGCCGCCGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1957602-1959068	Sequence	azo1790 rpoN2 RNA polymerase sigma-54 factor (Protein is coded in complementary strand; from 1959068 to 1957602)