Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2064171
End position: 2064194
Length: 24

DNA sequence
>NC_008702, from 2064171 to 2064194 (24 bp); Azoarcus sp. BH72 GAAGTCGAGGTCGAAGGCGAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2063554-2064687	Sequence	azo1880 - hypothetical protein (Protein is coded in complementary strand; from 2064687 to 2063554)