Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2097465
End position: 2097491
Length: 27

DNA sequence
>NC_008702, from 2097465 to 2097491 (27 bp); Azoarcus sp. BH72 TCACCAGCAACACCAGCATCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2097065-2097700	Sequence	azo1912 - hypothetical protein (Protein is coded in complementary strand; from 2097700 to 2097065)