Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2101711
End position: 2101740
Length: 30

DNA sequence
>NC_008702, from 2101711 to 2101740 (30 bp); Azoarcus sp. BH72 CAGCGCGAGCGCCACCGCCAGCGCCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2100821-2102704	Sequence	azo1915 dctB2 sensor histidine kinase (Protein is coded in complementary strand; from 2102704 to 2100821)