Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2116923
End position: 2116952
Length: 30

DNA sequence
>NC_008702, from 2116923 to 2116952 (30 bp); Azoarcus sp. BH72 GACCTCGATCTCGACCTTGGCCTCGTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2116903-2117298	Sequence	azo1928 abmE hypothetical protein (Protein is coded in complementary strand; from 2117298 to 2116903)