Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2329636
End position: 2329659
Length: 24

DNA sequence
>NC_008702, from 2329636 to 2329659 (24 bp); Azoarcus sp. BH72 GCCGGTGCTGGTGGCGGTGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2329257-2329883	Sequence	azo2123 tesA2 putative acyl-CoA thioesterase I