Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2562137
End position: 2562163
Length: 27

DNA sequence
>NC_008702, from 2562137 to 2562163 (27 bp); Azoarcus sp. BH72 CCGCCACCCCCGCCTCCCCCGCCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2561964-2562611	Sequence	azo2329 tonB2 periplasmic biopolymer transport protein linking inner and outer membranes