Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2733122
End position: 2733148
Length: 27

DNA sequence
>NC_008702, from 2733122 to 2733148 (27 bp); Azoarcus sp. BH72 GCTCCACCAGCTTCACCAGCTCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2732140-2733846	Sequence	azo2474 alsS acetolactate synthase catalytic subunit (Protein is coded in complementary strand; from 2733846 to 2732140)