Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2786159
End position: 2786182
Length: 24

DNA sequence
>NC_008702, from 2786159 to 2786182 (24 bp); Azoarcus sp. BH72 TGCCGGTGCCGGTGGCGGTGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2785687-2787012	Sequence	azo2519 dctM5 TRAP-type C4 dicarboxylate transport system large permease (Protein is coded in complementary strand; from 2787012 to 2785687)