Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2802118
End position: 2802141
Length: 24

DNA sequence
>NC_008702, from 2802118 to 2802141 (24 bp); Azoarcus sp. BH72 AGCGCCAGCGCAAGCCCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2801557-2802510	Sequence	azo2534 mdcF2 putative malonate transporter (Protein is coded in complementary strand; from 2802510 to 2801557)