Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 2838470
End position: 2838493
Length: 24

DNA sequence
>NC_008702, from 2838470 to 2838493 (24 bp); Azoarcus sp. BH72 TGCTGCTGCGGCTGCTGATGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2837663-2839060	Sequence	azo2561 - hypothetical protein (Protein is coded in complementary strand; from 2839060 to 2837663)