Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3006364
End position: 3006387
Length: 24

DNA sequence
>NC_008702, from 3006364 to 3006387 (24 bp); Azoarcus sp. BH72 CCGCCGCCGCGGCCGACGCGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3006109-3007209	Sequence	azo2721 fliK putative flagellar hook-length control protein FliK