Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3014896
End position: 3014922
Length: 27

DNA sequence
>NC_008702, from 3014896 to 3014922 (27 bp); Azoarcus sp. BH72 CGAGCTGGTCGCGCTGGTCGAGCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3013521-3015512	Sequence	azo2731 flgK flagellar hook-filament junction protein 1 (Protein is coded in complementary strand; from 3015512 to 3013521)