Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3367802
End position: 3367826
Length: 25

DNA sequence
>NC_008702, from 3367802 to 3367826 (25 bp); Azoarcus sp. BH72 AGGGGAGGGCTGGGGTGGGGATGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3367800-3370820	Sequence	azo3061 - diguanylate cyclase (Protein is coded in complementary strand; from 3370820 to 3367800)