Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3435808
End position: 3435831
Length: 24

DNA sequence
>NC_008702, from 3435808 to 3435831 (24 bp); Azoarcus sp. BH72 GCACCGGCACCGGTACCGGAACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3435648-3436235	Sequence	azo3127 - hypothetical protein (Protein is coded in complementary strand; from 3436235 to 3435648)