Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3458198
End position: 3458221
Length: 24

DNA sequence
>NC_008702, from 3458198 to 3458221 (24 bp); Azoarcus sp. BH72 CGAACGCGAGCGCGAGCGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3457702-3460452	Sequence	azo3149 pma1 putative cation-transporting P-type ATPase (Protein is coded in complementary strand; from 3460452 to 3457702)