Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3619720
End position: 3619743
Length: 24

DNA sequence
>NC_008702, from 3619720 to 3619743 (24 bp); Azoarcus sp. BH72 CGAACGCGAACACGAGCGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3618237-3619733	Sequence	azo3280 - hypothetical protein (Protein is coded in complementary strand; from 3619733 to 3618237)