Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3694849
End position: 3694878
Length: 30

DNA sequence
>NC_008702, from 3694849 to 3694878 (30 bp); Azoarcus sp. BH72 GGGAACGGAAGGGGCCGGAAGGAAGCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3694588-3694929	Sequence	azo3358 - hypothetical protein (Protein is coded in complementary strand; from 3694929 to 3694588)