Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3722555
End position: 3722578
Length: 24

DNA sequence
>NC_008702, from 3722555 to 3722578 (24 bp); Azoarcus sp. BH72 GCCAGCGCCACCGGCAGCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3721646-3722614	Sequence	azo3384 - putative aliphatic sulfonates binding protein (Protein is coded in complementary strand; from 3722614 to 3721646)