Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3723659
End position: 3723682
Length: 24

DNA sequence
>NC_008702, from 3723659 to 3723682 (24 bp); Azoarcus sp. BH72 GCACCAGCAGCAGCAACAGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3723325-3724530	Sequence	azo3386 - putative transport protein (Protein is coded in complementary strand; from 3724530 to 3723325)