Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 376146
End position: 376169
Length: 24

DNA sequence
>NC_008702, from 376146 to 376169 (24 bp); Azoarcus sp. BH72 AGGCCGATGCCGAAGCCGAGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 375522-376307	Sequence	azo0351 nodJ ABC transporter permease NodJ (Protein is coded in complementary strand; from 376307 to 375522)