Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 387153
End position: 387182
Length: 30

DNA sequence
>NC_008702, from 387153 to 387182 (30 bp); Azoarcus sp. BH72 GCGGCAGCAGCAGCGCCAGCGCCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 386915-388000	Sequence	azo0364 - hypothetical protein (Protein is coded in complementary strand; from 388000 to 386915)