Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 3919523
End position: 3919546
Length: 24

DNA sequence
>NC_008702, from 3919523 to 3919546 (24 bp); Azoarcus sp. BH72 CAGCAACAGCACCAGGAACAGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3918579-3920381	Sequence	azo3572 msbA2 lipid A export ATP-binding/permease (Protein is coded in complementary strand; from 3920381 to 3918579)