Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 404905
End position: 404928
Length: 24

DNA sequence
>NC_008702, from 404905 to 404928 (24 bp); Azoarcus sp. BH72 GTCGTCCTCGTCGTCGCCGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 403712-405787	Sequence	azo0378 - putative TonB-dependent receptor (Protein is coded in complementary strand; from 405787 to 403712)