Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 406249
End position: 406272
Length: 24

DNA sequence
>NC_008702, from 406249 to 406272 (24 bp); Azoarcus sp. BH72 GCGCCAGCACCAGCACCAGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 405969-406301	Sequence	azo0379 - hypothetical protein (Protein is coded in complementary strand; from 406301 to 405969)