Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 4180193
End position: 4180217
Length: 25

DNA sequence
>NC_008702, from 4180193 to 4180217 (25 bp); Azoarcus sp. BH72 GCGCGGCGCGGCGTGCCGCGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4179274-4180221	Sequence	azo3819 livM6 putative branched-chain amino acid transport permease (Protein is coded in complementary strand; from 4180221 to 4179274)