Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 4317870
End position: 4317893
Length: 24

DNA sequence
>NC_008702, from 4317870 to 4317893 (24 bp); Azoarcus sp. BH72 GTGCCGGTGGCGGTGGCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4317297-4318157	Sequence	azo3941 napG quinol dehydrogenase periplasmic protein (Protein is coded in complementary strand; from 4318157 to 4317297)