Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 4367445
End position: 4367468
Length: 24

DNA sequence
>NC_008702, from 4367445 to 4367468 (24 bp); Azoarcus sp. BH72 CAGGGTCAGCGTCAGCGTCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4366174-4368294	Sequence	azo3983 ntrY nitrogen regulation protein (Protein is coded in complementary strand; from 4368294 to 4366174)