Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 443930
End position: 443974
Length: 45

DNA sequence
>NC_008702, from 443930 to 443974 (45 bp); Azoarcus sp. BH72 GGCTCGGGCTTCTTCGGCTCGGGCTTGGGCGGTTCCGGCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 443450-444292	Sequence	azo0418 tolA hypothetical protein (Protein is coded in complementary strand; from 444292 to 443450)