Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 542558
End position: 542581
Length: 24

DNA sequence
>NC_008702, from 542558 to 542581 (24 bp); Azoarcus sp. BH72 GGTCGTGGTCGAGGCCGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 541320-542780	Sequence	azo0504 rpoN1 RNA polymerase factor sigma-54 (Protein is coded in complementary strand; from 542780 to 541320)